Stem-loop sequence mtr-MIR2111j

AccessionMI0011907 (change log)
DescriptionMedicago truncatula miR2111j stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111j
(8 sentences)

Stem-loop
   u      --       uua            c        u ua   auau 
5'  uauugg  guaagga   gauaaucugcau cugagguu a  aca    u
    ||||||  |||||||   |||||||||||| |||||||| |  |||     
3'  guaacc  uauuccu   cuauuagacgua gauuccaa u  ugu    u
   c      gu       uuc            a        u uc   cgau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16649192-16649293 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111j
mtr-MIR2111hchr7: 16655725-16655830 [-]
mtr-MIR2111ichr7: 16649857-16649962 [-]
mtr-MIR2111jchr7: 16649192-16649293 [-]
mtr-MIR2111kchr7: 16644233-16644366 [-]
mtr-MIR2111lchr7: 16644069-16644155 [-]
Database links

Mature sequence mtr-miR2111j

Accession MIMAT0013360
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).