Stem-loop sequence mtr-MIR2111k

AccessionMI0011908 (change log)
DescriptionMedicago truncatula miR2111k stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111k
(8 sentences)

Stem-loop
   a      --g      ug            uc ug          -    --a  uu  uca    cuu 
5'  uauugg   ugggga  ggauaaucugca  c  agguuuagaa caau   gu  cu   uuuc   a
    ||||||   ||||||  ||||||||||||  |  |||||||||| ||||   ||  ||   ||||    
3'  guaacu   auuccu  uuuauuagaugu  g  uccgaaucuu guua   cg  ga   aaag   a
   c      aca      uu            ua gu          u    aug  uu  -ua    aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16644233-16644366 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111k
mtr-MIR2111ichr7: 16649857-16649962 [-]
mtr-MIR2111jchr7: 16649192-16649293 [-]
mtr-MIR2111kchr7: 16644233-16644366 [-]
mtr-MIR2111lchr7: 16644069-16644155 [-]
mtr-MIR2111mchr7: 16637685-16637791 [-]
mtr-MIR2111nchr7: 16637529-16637662 [-]
Database links

Mature sequence mtr-miR2111k

Accession MIMAT0013361
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).