Stem-loop sequence mtr-MIR2628

AccessionMI0011909 (change log)
DescriptionMedicago truncatula miR2628 stem-loop
Stem-loop
   a   gacaa     c    ca    a   u             ccccaaccaauacauauuagccacauaagc 
5'  ggu     cuaag uacu  ugaa gaa gaugaguaauuua                              a
    |||     ||||| ||||  |||| ||| |||||||||||||                              c
3'  cca     gauuu augg  acuu cuu uuacucguuaaau                              a
   a   aaaaa     a    aa    -   -             aaacaccucaguuuuaucaaguacuuauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 13971174-13971320 [+]
intergenic
Database links

Mature sequence mtr-miR2628

Accession MIMAT0013362
Sequence

20 - 

caugaaagaaugaugaguaa

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).