Stem-loop sequence mtr-MIR2629d

AccessionMI0011911 (change log)
DescriptionMedicago truncatula miR2629d stem-loop
Gene family MIPF0000824; MIR2629
Stem-loop
   --cucga    uuac         u   c             u  au 
5'        uagu    ugccgaagu uuc ucgguaguuaacu cc  a
          ||||    ||||||||| ||| ||||||||||||| ||  a
3'        auca    auggcuuua gag agccgucaauuga gg  u
   caguaua    uuaa         c   u             c  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 15594507-15594601 [+]
intergenic
Database links

Mature sequence mtr-miR2629d

Accession MIMAT0013364
Sequence

20 - 

aguuuuccucgguaguuaacu

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).