Stem-loop sequence mtr-MIR2629e

AccessionMI0011912 (change log)
DescriptionMedicago truncatula miR2629e stem-loop
Gene family MIPF0000824; MIR2629
Stem-loop
   -        -guu     cgg    u                  ca ucaguuc 
5'  aagaugca    aauug   aagu uuccucgguaguuaacug  g       c
    ||||||||    |||||   |||| ||||||||||||||||||  |       a
3'  uuuuaugu    uuaau   uuua agggagccgucgauugac  c       a
   g        auau     aag    c                  ag uuaaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 28317266-28317374 [+]
intergenic
Database links

Mature sequence mtr-miR2629e

Accession MIMAT0013365
Sequence

21 - 

aguuuuccucgguaguuaacu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).