Stem-loop sequence mtr-MIR2629c

AccessionMI0011914 (change log)
DescriptionMedicago truncatula miR2629c stem-loop
Gene family MIPF0000824; MIR2629
Stem-loop
   aaguuu                  agu   uuc 
5'       uccucgguaguuaacugc   cgg   c
         ||||||||||||||||||   |||   a
3'       gggagccgucaauugacg   gcu   u
   -----g                  ---   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 8596645-8596705 [+]
intergenic
Database links

Mature sequence mtr-miR2629c

Accession MIMAT0013367
Sequence

2 - 

aguuuuccucgguaguuaacu

 - 22

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).