Stem-loop sequence mtr-MIR2629f

AccessionMI0011915 (change log)
DescriptionMedicago truncatula miR2629f stem-loop
Gene family MIPF0000824; MIR2629
Stem-loop
   c     g  u                 u      ga  a   u 
5'  aggac ca cggcaguuaacugcuga ggaaac  ug uag u
    ||||| || ||||||||||||||||| ||||||  || |||  
3'  ucuug gu gccgucaauugauggcu cuuuug  gc guc a
   u     -  c                 c      aa  c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 20006463-20006549 [-]
intergenic
Database links

Mature sequence mtr-miR2629f

Accession MIMAT0013368
Sequence

54 - 

aguuuuccucgguaguuaacu

 - 74

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).