Stem-loop sequence mtr-MIR2629g

AccessionMI0011916 (change log)
DescriptionMedicago truncatula miR2629g stem-loop
Gene family MIPF0000824; MIR2629
Stem-loop
   a   au    ucagcua            aaa          a      a                         uuuaacaccucaugcucuuuauuaaaugcauacguuauaucauuuaauaaagaguaugugg 
5'  auu  ggaa       caguuaauuauc   gaaaacuucg caguua uugccgcggaguuuuaaaauuaaaa                                                             u
    |||  ||||       ||||||||||||   |||||||||| |||||| |||||||||||||||||||||||||                                                             g
3'  uag  ccuu       gucaauugaugg   cuuuugaagc gucaau gacggcgccucaaaguuuuaauuuu                                                             u
   a   cu    ugaaaac            cuc          c      -                         aaauuguguguacguguauagacgguaaauaaauacaauuauaguuuaauuuaauuuaguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 13457501-13457774 [+]
intergenic
Database links

Mature sequence mtr-miR2629g

Accession MIMAT0013369
Sequence

236 - 

aguuuuccucgguaguuaacu

 - 256

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).