Stem-loop sequence mtr-MIR2630b

AccessionMI0011918 (change log)
DescriptionMedicago truncatula miR2630b stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630b
(2 sentences)

Stem-loop
   -     c          u                               a            cau         aaaaug    cua      ----------uc           cgu 
5'  cucug aaauauaaaa auuugguuuugguccuugguauuuuguuuua uccuuguaaaau   uucauauug      gucc   uaauau            auuuuaguccu   u
    ||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||   |||||||||      ||||   ||||||            |||||||||||    
3'  gagac uuuauauuuu uaaaccaaaaccaggaaccauaaaauaaaau aggaacauuuua   aaguauaac      cagg   auuaua            uaaaaucaggg   u
   a     a          u                               c            acu         cuaaaa    aac      caucuuauaaac           agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 552478-552706 [-]
intergenic
Database links

Mature sequence mtr-miR2630b

Accession MIMAT0013371
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).