Stem-loop sequence mtr-MIR2630c

AccessionMI0011919 (change log)
DescriptionMedicago truncatula miR2630c stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630c
(2 sentences)

Stem-loop
   c    -      -     ua                              a            cau         aaa      ccua     ----------  c           cgu 
5'  cauu caaaua aagaa  uuugguuuugguccuugguauuuuguuuua ucuuuguaaaau   uucauauug   uugguc    uaaua          uu auuuuaguccu   u
    |||| |||||| |||||  |||||||||||||||||||||||||||||| ||||||||||||   |||||||||   ||||||    |||||          || |||||||||||    
3'  guga guuuau uuuuu  aaaccaaaaccaggaaccauaaaacaaaau aggaacauuuua   aaguauaac   aaccag    auuau          aa uaaaaucaggg   u
   a    c      a     ua                              c            ucu         cua      aaac     ccaucuuaua  c           agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 23684220-23684449 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2630c
mtr-MIR2630wchr1: 23684222-23684450 [+]
mtr-MIR2630cchr1: 23684220-23684449 [-]
Database links

Mature sequence mtr-miR2630c

Accession MIMAT0013372
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).