Stem-loop sequence mtr-MIR2630w

AccessionMI0011920 (change log)
DescriptionMedicago truncatula miR2630w stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630w
(2 sentences)

Stem-loop
   a  --g      uaaaaaau                                 c         aga           u               gguagaauau  g          c  a 
5'  cu   caaaua        uuugguuuugguccuugguauuuuguuuuaguc uuguaaaau   uucauauugga uuggucuuuguaaua          uu auuuuagucc uc a
    ||   ||||||        ||||||||||||||||||||||||||||||||| |||||||||   ||||||||||| |||||||||||||||          || |||||||||| || a
3'  gg   guuuau        aaaccaaaaccaggaaccauaaaacaaaauuag aacauuuua   aaguauaacuu aaccagggauauuau          aa uaaaaucagg ag a
   a  uaa      -uucuuau                                 a         gua           u               ----------  g          -  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 23684222-23684450 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2630w
mtr-MIR2630cchr1: 23684220-23684449 [-]
mtr-MIR2630wchr1: 23684222-23684450 [+]
Database links

Mature sequence mtr-miR2630w

Accession MIMAT0013373
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).