Stem-loop sequence mtr-MIR2630x

AccessionMI0011921 (change log)
DescriptionMedicago truncatula miR2630x stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630x
(2 sentences)

   c            aaaaaa                            a               a           u                guagaauauu g          c  a 
5'  ccugcaaauaua      uugguuuugguccuugguauuuuguuuu guccuuguaaaauug uucauauugga uuggucuuuguaauau          u auuuuagucc uc a
    ||||||||||||      |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||          | |||||||||| || a
3'  ggacguuuauau      aaccaaaaccaggaaccauaaaacaaaa uaggaacauuuuagu aaguauaacuu aaccagggauauuaua          a uaaaaucagg ag a
   a            cuuaua                            c               a           u                ---------- g          -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 27586224-27586451 [+]
Database links

Mature sequence mtr-miR2630x

Accession MIMAT0013374

21 - 


 - 41

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).