Stem-loop sequence mtr-MIR2630y

AccessionMI0011922 (change log)
DescriptionMedicago truncatula miR2630y stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630y
(2 sentences)

Stem-loop
   a           a  a                                              a           u      a         guagaauauu g          c  a 
5'  cugcaaauaua aa auuugguuuugguccuugguauuuuguuuuaguccuuguaaaauug uucauauugga uugguc uuguaauau          u auuuuagucc uc a
    ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||          | |||||||||| || a
3'  gacguuuauau uu uaaaccaaaacuaggaaccauaaaacaaaauuaggaacauuuuagu aaguauaacuu aaccag gauauuaua          a uaaaaucagg ag a
   g           c  a                                              a           u      g         ---------- g          -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 11627635-11627860 [-]
intergenic
Database links

Mature sequence mtr-miR2630y

Accession MIMAT0013375
Sequence

20 - 

ugguuuugguccuugguauuu

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).