Stem-loop sequence mtr-MIR2630d

AccessionMI0011923 (change log)
DescriptionMedicago truncatula miR2630d stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630d
(2 sentences)

Stem-loop
   -  aua           u                               a           ucau         aaa       cua      ----------uc          -  a 
5'  cc   caaauauagaa auuugguuuugguccuugguauuuuguuuua ucuuuguaaaa    uucauauug   uuggucc   uaauau            auuuuagucc uc u
    ||   ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    |||||||||   |||||||   ||||||            |||||||||| || u
3'  gg   guuuauaucuu uaaaccaaaaccaggaaccauaaaacaaaau aggaacauuuu    aaguauaac   aaccagg   auuaua            uaaaaucagg ag u
   a  aac           u                               c           cacu         cua       aac      caucuuauaaac          g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 23128153-23128381 [-]
intergenic
Database links

Mature sequence mtr-miR2630d

Accession MIMAT0013376
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).