Stem-loop sequence mtr-MIR2630f

AccessionMI0011925 (change log)
DescriptionMedicago truncatula miR2630f stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630f
(2 sentences)

   -  c          u  u                                            -c    c      aaa       cua      ----------uc           cgu 
5'  cc ugcaaauaua aa auuugguuuugguccuugguauuuuguuuuaauccuuguaaaau  auuu auauug   uuggucc   uaauau            auuuuaguccu   u
    || |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||  |||| ||||||   |||||||   ||||||            |||||||||||    
3'  gg acguuuauau uu uaaaccaaaaccaggaaccauaaaacaaaauuaggaacauuuua  uaaa uauaac   aaccagg   auuaua            uaaaaucaggg   u
   a  a          u  u                                            ac    -      cua       aac      caucuuauaaac           agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 38109549-38109777 [+]
Database links

Mature sequence mtr-miR2630f

Accession MIMAT0013378

21 - 


 - 41

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).