Stem-loop sequence mtr-MIR2630g

AccessionMI0011926 (change log)
DescriptionMedicago truncatula miR2630g stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630g
(2 sentences)

Stem-loop
   -                u                 g           c a  c   u     cau         aaa       cua      ucauuuuaguccucauuuuga 
5'  cccugcaaauauagaa auuugguuuugguccuu guauuuuguuu a uc uug aaaau   uucauauug   uuggucc   uaauau                     g
    |||||||||||||||| ||||||||||||||||| ||||||||||| | || ||| |||||   |||||||||   |||||||   ||||||                      
3'  gggacguuuauauuuu uaaaccaaaaccaggag cauaaaauaaa u ag aac uuuua   aaguauaac   aaccagg   auuaua                     g
   a                u                 a           a c  a   u     acu         cua       aac      cauuuuauaaacuaaaaacag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 28083847-28084075 [+]
intergenic
Database links

Mature sequence mtr-miR2630g

Accession MIMAT0013379
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).