Stem-loop sequence mtr-MIR2630i

AccessionMI0011928 (change log)
DescriptionMedicago truncatula miR2630i stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630i
(2 sentences)

Stem-loop
   c           a   u                               a            cau         aaauugguccauauaauauucauuuuaguccucauauuga 
5'  ccugcaaauau gaa auuugguuuugguccuugguauuuuguuuua uccuuguaaaau   uucauauug                                        g
    ||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||   |||||||||                                         
3'  ggacguuuaua uuu uaaaccaaaaccaggaaccauaaaacaaaau aggaacauuuua   aaguauaac                                        g
   a           a   u                               c            acu         cuaaaacaagaacaucauacaucuuauaaacuaaaaucug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 1908805-1909032 [-]
intergenic
Database links

Mature sequence mtr-miR2630i

Accession MIMAT0013381
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).