Stem-loop sequence mtr-MIR2630l

AccessionMI0011931 (change log)
DescriptionMedicago truncatula miR2630l stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630l
(2 sentences)

Stem-loop
   -                u                             uaauc          -c    c        a         a      ----------uc           cau 
5'  cucugcaaauauagaa auuugguuuugguccuugguauuuuguuu     cuuguaaaau  auuu auauugaa uugguccuu uaauau            auuuuaguccu   u
    |||||||||||||||| |||||||||||||||||||||||||||||     ||||||||||  |||| |||||||| ||||||||| ||||||            |||||||||||    
3'  gggacguuuauauuuu uaaaccaaaaccaggaaccauaaaacaaa     gaacauuuua  uaaa uauaacuu aaccaggaa auuaua            uaaaaucagga   u
   a                u                             uucaa          ac    -        a         c      caucuuauaaac           agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 15543381-15543609 [+]
intergenic
Database links

Mature sequence mtr-miR2630l

Accession MIMAT0013384
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).