Stem-loop sequence mtr-MIR2630m

AccessionMI0011932 (change log)
DescriptionMedicago truncatula miR2630m stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630m
(2 sentences)

Stem-loop
   -    -                                            a            cau        aaaa       cua      -  ---------          -  a 
5'  uccu gcaaauauagaauauuugguuuugguccuugguauuuuguuuua uccuuguaaaau   uucauauu    uuggucc   uaauau uc         auuuuagucc uc u
    |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||   ||||||||    |||||||   |||||| ||         |||||||||| || u
3'  agga cguuuauaucuuauaaaccaaaaccaggaaccauaaaacaaaau aggaacauuuua   aaguauaa    aaccagg   auuaua ag         uaaaaucagg ag u
   c    a                                            c            acu        ccua       aac      c  cuuauaaac          g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 18370582-18370811 [-]
intergenic
Database links

Mature sequence mtr-miR2630m

Accession MIMAT0013385
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).