Stem-loop sequence mtr-MIR2630n

AccessionMI0011933 (change log)
DescriptionMedicago truncatula miR2630n stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630n
(2 sentences)

Stem-loop
   -                               c                a            cau         aaauc     cua      ----------uc         -c  a 
5'  cccugcaaauauagaauauuugguuuugguc uugguauuuuguuuua uccuuguaaaau   uucauauug     ggucc   uaauau            auuuuaguc  uc u
    ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||   |||||||||     |||||   ||||||            |||||||||  || u
3'  gggacguuuauauuuuauaaaccaaaaccag aaccauaaaacaaaau aggaacauuuua   aaguauaac     ccagg   auuaua            uaaaaucag  ag u
   a                               a                c            acu         cuaaa     aac      caucuuauaaac         ua  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 5676117-5676345 [-]
intergenic
Database links

Mature sequence mtr-miR2630n

Accession MIMAT0013386
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).