Stem-loop sequence mtr-MIR2630p

AccessionMI0011935 (change log)
DescriptionMedicago truncatula miR2630p stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630p
(2 sentences)

Stem-loop
   -  cu            u          -    c                a            cauu        aaa       cuauaauauucauuuuaguccucauuuuga 
5'  cc  gcaaauauagaa auuugguuuu gguc uugguauuuuguuuua uccuuguaaaau    ucauauug   uuggucc                              g
    ||  |||||||||||| |||||||||| |||| |||||||||||||||| ||||||||||||    ||||||||   |||||||                               
3'  gg  cguuuauauuuu uaaaccaaaa ccag aaccauaaaacaaaau aggaacauuuua    aguauaac   aaccagg                              g
   a  uu            u          a    u                c            accu        cua       aacauuauacaucuuauaaaauaaaaucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 4799279-4799508 [+]
intergenic
Database links

Mature sequence mtr-miR2630p

Accession MIMAT0013388
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).