Stem-loop sequence mtr-MIR2630q

AccessionMI0011936 (change log)
DescriptionMedicago truncatula miR2630q stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630q
(2 sentences)

Stem-loop
   -  a          u  u                               a            cau         aaa       cua      ----------uc           cgu 
5'  cc ugcaaauaua aa auuugguuuugguccuugguauuuuguuuua uccuuguaaaau   uucauauug   uuggucc   uaauau            auuuuaguccu   u
    || |||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||   |||||||||   |||||||   ||||||            |||||||||||    
3'  gg acguuuauau uu uaaaccaaaaccaggaaccauaaaacaaaau aggaacauuuua   aaguauaac   aaccagg   auuaua            uaaaaucaggg   u
   g  -          u  u                               c            acu         cua       aac      caucuuauaaac           agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 18839111-18839338 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2630q
mtr-MIR156gchr6: 18847298-18847417 [-]
mtr-MIR2630qchr6: 18839111-18839338 [-]
Database links

Mature sequence mtr-miR2630q

Accession MIMAT0013389
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).