Stem-loop sequence mtr-MIR2630r

AccessionMI0011937 (change log)
DescriptionMedicago truncatula miR2630r stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630r
(2 sentences)

Stem-loop
   -                u                               a  c         cau           a       cua      ----------uc          -  a 
5'  cccugcaaauauagaa auuugguuuugguccuugguauuuuguuuua uc uuguaaaau   uucauguugaa uuggucc   uaauau            auuuuagucu uc u
    |||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||   ||||||||||| |||||||   ||||||            |||||||||| || u
3'  gggacguuuauauuuu uaaacuaaaaccaggaaccauaaaacaaaau ag aacauuuua   aaguauaacuu aaccagg   auuaua            uaaaaucagg ag u
   a                u                               c  a         acu           a       aac      caucuuauaaac          g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 11208478-11208706 [-]
intergenic
Database links

Mature sequence mtr-miR2630r

Accession MIMAT0013390
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).