Stem-loop sequence mtr-MIR2630t

AccessionMI0011939 (change log)
DescriptionMedicago truncatula miR2630t stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630t
(2 sentences)

Stem-loop
   -         a      u   u        u    g             a            cau   u     aaa       cua      ----------uc           cgu 
5'  cccugcaaa auagaa auu gguuuugg ccuu guauuuuguuuua uccuuguaaaau   uuc uauug   uuggucc   uaauau            auuuuaguccu   u
    ||||||||| |||||| ||| |||||||| |||| ||||||||||||| ||||||||||||   ||| |||||   |||||||   ||||||            |||||||||||    
3'  gggacguuu uauuuu uaa ccaaaacc ggaa cauaaaacaaaau aggaacauuuua   aag auaac   aaccagg   auuaua            uaaaaucaggg   u
   a         a      u   c        u    a             a            acu   u     cua       aac      caucuuauaaac           agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 208036-208264 [-]
intergenic
Database links

Mature sequence mtr-miR2630t

Accession MIMAT0013392
Sequence

21 - 

ugguuuugguccuugguauuu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).