Stem-loop sequence mtr-MIR2630u

AccessionMI0011940 (change log)
DescriptionMedicago truncatula miR2630u stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630u
(2 sentences)

   -  a             u                               a            -cauu        aaa      ccuauaauauucauuuuaguccucguuuuga 
5'  cc ugcaaauauagaa auuugguuuugguccuugguauuuuguuuua uccuuguaaaau     ucauauug   uugguc                               g
    || ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||     ||||||||   ||||||                                
3'  gg acguuuauauuuu uaaaccaaaaccaggaaucauaaaacaaaau aggaacauuuua     aguauaac   aaccag                               g
   g  -             u                               c            aauuu        cua      aaacauuauacaucuuauaaacuaaaaucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 20150884-20151112 [+]
Database links

Mature sequence mtr-miR2630u

Accession MIMAT0013393

21 - 


 - 41

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).