Stem-loop sequence mtr-MIR2630v

AccessionMI0011941 (change log)
DescriptionMedicago truncatula miR2630v stem-loop
Gene family MIPF0000814; MIR2630
Literature search

2 open access papers mention mtr-MIR2630v
(2 sentences)

   c  -ua           u        u                      a  a         cau         aaa       cua      ----------uc          -  a 
5'  cc   caaauauagaa auuugguu ugguccuugguauuuuguuuua uc uuguaaaau   uucauauug   uuggucc   uaauau            auuuuagucc uc u
    ||   ||||||||||| |||||||| |||||||||||||||||||||| || |||||||||   |||||||||   |||||||   ||||||            |||||||||| || u
3'  gg   guuuauauuuu uaaaccaa accaggaaccauaaaacaaaau ag aacauuuua   aaguauaac   aaccagg   auuaua            uaaaaucagg ag u
   c  uac           u        u                      c  g         acu         cua       aac      caucuuauaaac          g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 38608657-38608885 [+]
Database links

Mature sequence mtr-miR2630v

Accession MIMAT0013394

21 - 


 - 41

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).