Stem-loop sequence mtr-MIR2631

AccessionMI0011942 (change log)
DescriptionMedicago truncatula miR2631 stem-loop
Stem-loop
   -              c            c  c               acu        agaguuugaaguuaaaagauauuucguccacacuuuugguaaauaaaauuuaauuauuaaaacugucaaugauaaaaaaaaauucuuuuucuuaaaaaaaaa 
5'  ugugccacguggac aaucaugacacg ca guggcacacuagaag   aaauuuug                                                                                                      a
    |||||||||||||| |||||||||||| || |||||||||||||||   ||||||||                                                                                                       
3'  acacggugcaccug uuaguauugugc gu caccgugugauuuuu   uuuaaaau                                                                                                      a
   c              -            u  a               -gu        auuaacuuuauuuauuuaauuuuauuccguuuaagauaccauguagguuuuuaaacucacauggucaugugguuuaacaauuuaauuauuaauuuacucaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 16639232-16639550 [-]
intergenic
Database links

Mature sequence mtr-miR2631

Accession MIMAT0013395
Sequence

21 - 

ugacacgccacguggcacacu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).