Stem-loop sequence mtr-MIR2632a

AccessionMI0011943 (change log)
DescriptionMedicago truncatula miR2632a stem-loop
Gene family MIPF0001203; MIR2632
Stem-loop
   -                 a  c                             c                                 -    auc 
5'  aggucauuugaauuuuc uc cugaaguuacuaauccuuccaaucugccc ugcaaauauuaaucauuugacuuuugguccuaa uuac   u
    ||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||   g
3'  uccgguaaacuuaaaag ag gacuucaaugauuaggaagguuagacggg acguuuauaauuaguaaacugaaaaccaggauu aaug   a
   a                 c  c                             a                                 c    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 14319353-14319539 [+]
intergenic
Database links

Mature sequence mtr-miR2632a

Accession MIMAT0013396
Sequence

21 - 

ccugaaguuacuaauccuucca

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).