Stem-loop sequence mtr-MIR2632b

AccessionMI0011944 (change log)
DescriptionMedicago truncatula miR2632b stem-loop
Gene family MIPF0001203; MIR2632
Stem-loop
   a   -             a  c                   c         c                            a    cagcccaccuca 
5'  agu cauuugaauuuuc uc cugaaguuacuaauccuuc aaucugccc ugcaaauauuaaucauuugacuuuuggu auga            g
    ||| ||||||||||||| || ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||             
3'  uca guaaacuuaaaag ag gacuucaaugauuaggaag uuagacggg acguuuauaauuaguaaauugaaaacca uauu            c
   a   a             c  a                   a         -                            g    aauccaaaaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 12646949-12647142 [-]
intergenic
Database links

Mature sequence mtr-miR2632b

Accession MIMAT0013397
Sequence

21 - 

ccugaaguuacuaauccuucca

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).