Stem-loop sequence mtr-MIR2632c

AccessionMI0011945 (change log)
DescriptionMedicago truncatula miR2632c stem-loop
Gene family MIPF0001203; MIR2632
Stem-loop
   -agac            c                      c    a        c                       aucauaauuacaucugauuaguaacuucagugaugaaaauucaagugaccuauauuuggagggaugaaagaccuauuuaagc 
5'      cauuugaauuuu gucccugaaguuacuaauccuu caau ugccccug aaauauuaaucauuugacuuuug                                                                                  a
        |||||||||||| |||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||                                                                                  a
3'      guaaacuuaaaa cagggacuucaaugauuaggaa guua acgggggc uuuauaauuaguaaacugaaaac                                                                                  a
   aucca            u                      a    g        a                       gaggauuaauccaaaaaaaccacuccacccaacaguaaucgcugcaccacggguacaccguucacuacuaacccgauccacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 46415896-46416217 [+]
intergenic
Database links

Mature sequence mtr-miR2632c

Accession MIMAT0013398
Sequence

21 - 

ccugaaguuacuaauccuucca

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).