Stem-loop sequence mtr-MIR2633

AccessionMI0011946 (change log)
DescriptionMedicago truncatula miR2633 stem-loop
Stem-loop
   u   c     aau       u     u  u        g    cu u     -      u 
5'  uga uaaac   guuaugu agucu ga caaagugu aucu  g agucc cuaacu c
    ||| |||||   ||||||| ||||| || |||||||| ||||  | ||||| |||||| u
3'  acu auuug   caauaca uuaga cu guuuuaca uaga  c uuagg gauugg a
   u   u     ---       c     c  c        g    au -     c      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 25828393-25828510 [+]
intergenic
Database links

Mature sequence mtr-miR2633

Accession MIMAT0013399
Sequence

82 - 

ugacauuuugcuccagauuca

 - 102

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).