Stem-loop sequence mtr-MIR2634

AccessionMI0011947 (change log)
DescriptionMedicago truncatula miR2634 stem-loop
Stem-loop
   a   ua  c     ac  u         c     u  a    ---au   uu 
5'  uuc  gc augau  ga caacaaacu agaau ga gagu     ggc  a
    |||  || |||||  || ||||||||| ||||| || ||||     |||   
3'  aag  cg uacua  cu guuguuuga ucuua uu cuca     ucg  a
   a   gc  a     ca  c         c     u  c    cagau   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 30275846-30275948 [-]
intergenic
Database links

Mature sequence mtr-miR2634

Accession MIMAT0013400
Sequence

67 - 

uuuauucucaguuuguugcuc

 - 87

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).