Stem-loop sequence mtr-MIR2635

AccessionMI0011948 (change log)
DescriptionMedicago truncatula miR2635 stem-loop
Stem-loop
   a    uua  -         a   uc   g   c   aauauaaagagucacacacaaagaacggucaaaagagaaa 
5'  aaua   ga uuuaauauu uug  aac uga uag                                        u
    ||||   || ||||||||| |||  ||| ||| |||                                        a
3'  uuau   cu aaauuauaa aac  uug auu auc                                        u
   g    -ug  c         -   ga   -   a   acaauaaaugauuugcguauggauauauucagugugaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 4841515-4841667 [+]
intergenic
Database links

Mature sequence mtr-miR2635

Accession MIMAT0013401
Sequence

17 - 

auuauugucaacgugacuag

 - 36

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).