Stem-loop sequence mtr-MIR2636

AccessionMI0011949 (change log)
DescriptionMedicago truncatula miR2636 stem-loop
Gene family MIPF0000913; MIR2599
Stem-loop
   g         g     c   u    aaa               -   g      cuaa  ua 
5'  uggguacaa gaauc acu uauu   cacacuaaccaaaaa acu uaauuu    ga  u
    ||||||||| ||||| ||| ||||   ||||||||||||||| ||| ||||||    ||   
3'  acccauguu cuuag uga auaa   gugugauugguuuuu ugg auuaaa    cu  g
   -         a     a   u    guc               g   a      ----  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 27514652-27514771 [-]
intergenic
Database links

Mature sequence mtr-miR2636

Accession MIMAT0013402
Sequence

81 - 

uuugguuagugugcugaauau

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).