Stem-loop sequence mtr-MIR2637

AccessionMI0011950 (change log)
DescriptionMedicago truncatula miR2637 stem-loop
Stem-loop
   aauuauuauauucacuuua            c        ----      a  g   aacaacuuuu 
5'                    uaaauacuuccu ugaucacu    guuaua ac aaa          u
                      |||||||||||| ||||||||    |||||| || |||           
3'                    auuuaugaggga gcuaguga    uaguau ug uuu          a
   --------cuaaccauaua            a        uaua      c  g   auauaguuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 11864066-11864189 [+]
intergenic
Database links

Mature sequence mtr-miR2637

Accession MIMAT0013403
Sequence

21 - 

aaauacuuccucugaucacug

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).