Stem-loop sequence mtr-MIR2638b

AccessionMI0011952 (change log)
DescriptionMedicago truncatula miR2638b stem-loop
Gene family MIPF0001203; MIR2632
Stem-loop
   g         c                                  aaaaua          caucugauuaguaacuuuagggaugaaaauucaaaugauauauauuugcagggacaaaagaccuauuuaagcc 
5'  uuacuaauc uuccaaucugccacugcaaauauuaaucauuuga      guccuaauua                                                                         a
    ||||||||| ||||||||||||||||||||||||||||||||||      ||||||||||                                                                          
3'  aaugauuag aagguuagacggugacguuuauaauuaguaaacu      caggauuaau                                                                         a
   -         u                                  gaaaac          caaaaaaaaacgacucuacccgauaguaaucgcugcaccacggauacaccguucacuacuaaccugcuccacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 6758482-6758750 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2638b
mtr-MIR2638bchr5: 6758482-6758750 [-]
mtr-MIR2638achr5: 6758481-6758749 [+]
Database links

Mature sequence mtr-miR2638b

Accession MIMAT0013405
Sequence

230 - 

augauuaauauuugcaguggc

 - 250

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).