Stem-loop sequence mtr-MIR2639

AccessionMI0011953 (change log)
DescriptionMedicago truncatula miR2639 stem-loop
Stem-loop
   c  a   ugaauu          -  ac    uu        g     a 
5'  ag ccu      uaucaaggug ug  aguc  acugaauu ccaau c
    || |||      |||||||||| ||  ||||  |||||||| |||||  
3'  uc ggg      auaguuccac gc  ucgg  ugauuuaa gguua a
   a  a   -ugaau          u  au    -c        a     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 10235233-10235329 [+]
intergenic
Database links

Mature sequence mtr-miR2639

Accession MIMAT0013406
Sequence

62 - 

uagucggcuuacgucaccuug

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).