Stem-loop sequence mtr-MIR2640

AccessionMI0011954 (change log)
DescriptionMedicago truncatula miR2640 stem-loop
Stem-loop
   a   c    cg      ga  a    uaaa      uuc     uacuauuguugcaaaauauaacuuucuuguacugaaauuaguuaggcuuaggcggcauaaaccuuuucuacacauuugacucaaugaauuuuuuaagggauuua 
5'  uuc uugc  gagcug  cu cagg    aguuaa   agaga                                                                                                        a
    ||| ||||  ||||||  || ||||    ||||||   |||||                                                                                                         
3'  aag aacg  uuugau  gg gucu    ucaauu   ucucu                                                                                                        a
   -   a    uu      aa  a    ----      ---     cuccgcacgccgaccgaugagugaucacauuaguauuaagauccauucaugagaugaauaaagaguuauaaccguacauuaaguucuuuuaucuuaccaacgag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 33982196-33982485 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2640
mtr-MIR5267fchr1: 33986835-33986915 [+]
mtr-MIR2640chr1: 33982196-33982485 [-]
Database links

Mature sequence mtr-miR2640

Accession MIMAT0013407
Sequence

2 - 

uuccuugccggagcuggacuac

 - 23

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).