Stem-loop sequence mtr-MIR2641

AccessionMI0011956 (change log)
DescriptionMedicago truncatula miR2641 stem-loop
Stem-loop
   uguuugauccuuuacguuuauucuucguuuuagguaggagauguaaauuucuucaugcaaauccucgugaaaagaaaaaaaaaaaaacaucagcauggaaggaacauagaaaa      u    -    g   g   accccu 
5'                                                                                                                  ggagaa aaga ccaa uug auc      a
                                                                                                                    |||||| |||| |||| ||| |||      a
3'                                                                                                                  ucucuu uucu gguu aac uag      a
   -------------------------------------------------------uugggaaaguaaguagguacuuuuuuaguuaguguuaucuuuagcuaacauggaauac      -    a    g   -   aaaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 1951990-1952220 [+]
intergenic
Database links

Mature sequence mtr-miR2641

Accession MIMAT0013409
Sequence

2 - 

guuugauccuuuacguuuau

 - 21

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).