Stem-loop sequence mtr-MIR2642

AccessionMI0011957 (change log)
DescriptionMedicago truncatula miR2642 stem-loop
Stem-loop
   -              a        a       c    -c        
5'  uuugauugguuaaa uuuacaug guuucau aaau  auguggu 
    |||||||||||||| |||||||| ||||||| ||||  |||||| u
3'  aaacuaaccaauuu aaguguau cagagug uuua  uauaccc 
   g              c        g       u    aa        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 1759989-1760079 [+]
intergenic
Database links

Mature sequence mtr-miR2642

Accession MIMAT0013410
Sequence

21 - 

augaguuucaucaaaucaugu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).