Stem-loop sequence mtr-MIR2643a

AccessionMI0011958 (change log)
Previous IDsmtr-MIR2643
DescriptionMedicago truncatula miR2643 stem-loop
Stem-loop
   a     uugc   -u     uu     uc     u  g g     ccuu    ua   a    augaauugggguccaagggaagggccuaaagguccaaaacaaaaggauuuuuggaaag 
5'  aauag    ugc  gaaua  uggga  agaaa ua a agcca    ggcu  acu ugag                                                          g
    |||||    |||  |||||  |||||  ||||| || | |||||    ||||  ||| ||||                                                          a
3'  uuauc    aug  uuugu  auucu  uuuuu au u uuggu    ucgg  uga acuu                                                          g
   a     ccau   uu     -u     uu     u  g g     ----    uc   -    auaauuuguuuuccaguuagugcccacuuuuuguaguauucuugcugaguggcaagca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 19533371-19533608 [-]
intergenic
Database links

Mature sequence mtr-miR2643a

Accession MIMAT0013411
Previous IDsmtr-miR2643
Sequence

20 - 

uuugggaucagaaauuagaga

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).