Stem-loop sequence mtr-MIR2644

AccessionMI0011959 (change log)
DescriptionMedicago truncatula miR2644 stem-loop
Stem-loop
   u       uug    agug        u ug           caa         gguuacuagcagcagcgaaggguauuuagguuauugaaauaucaucaaaaauaaac 
5'  cgugucg   acca    gauacacc u  aucugaagugu   ugcuacaua                                                        u
    |||||||   ||||    |||||||| |  |||||||||||   |||||||||                                                        u
3'  gcacagc   uggu    cugugugg a  uagacuucaca   acgauguau                                                        u
   u       cua    ----        u gu           acc         uagaauuacauaguaagauuacacuuugagaauucucugaaaccacaaaacaacug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 17526726-17526944 [+]
intergenic
Database links

Mature sequence mtr-miR2644

Accession MIMAT0013412
Sequence

183 - 

cacuucagauugauggugugu

 - 203

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).