Stem-loop sequence mtr-MIR2645

AccessionMI0011961 (change log)
DescriptionMedicago truncatula miR2645 stem-loop
Literature search

1 open access papers mention mtr-MIR2645
(1 sentences)

Stem-loop
   --------------------------------------------------auuucuagagaugagcauauauugaag      --g     -   g      ac     ---  cu u uug       cua 
5'                                                                              aauuau   gagua gau aaguuu  aaagu   uc  c c   gauugga   a
                                                                                ||||||   ||||| ||| ||||||  |||||   ||  | |   |||||||   c
3'                                                                              uugaua   uuuau cua uucaaa  uuucg   ag  g g   uuaacuu   u
   guuuuuacuuggguuaugaaauuaacguucaccauccgguaaccguauuacaucauacgguaauugguugggaagua      agu     a   g      -c     aaa  cu u uua       cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 27289822-27290031 [+]
intergenic
Database links

Mature sequence mtr-miR2645

Accession MIMAT0013414
Sequence

2 - 

uuucuagagaugagcauauau

 - 22

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).