Stem-loop sequence mtr-MIR2647c

AccessionMI0011966 (change log)
DescriptionMedicago truncatula miR2647c stem-loop
Gene family MIPF0000887; MIR2647
   ----------------------------------------------------------------------------aauucacggggacgaaccuccuucg     ag --u   u     cu    aua    ua 
5'                                                                                                      uugaa  u   ugc uuauu  uuug   uauc  u
                                                                                                        |||||  |   ||| |||||  ||||   ||||  c
3'                                                                                                      aacuu  a   acg aauga  gaac   auag  c
   aaguuguccccguugggagggagguagggagucauaguugaauuuccaacauggaggacaccucagggcaguugccuuuaagacuacuuccgguucgaacu     ga uuu   u     ag    ---    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 41982156-41982349 [+]
Database links

Mature sequence mtr-miR2647c

Accession MIMAT0013419

2 - 


 - 22

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).