Stem-loop sequence mtr-MIR2648

AccessionMI0011967 (change log)
DescriptionMedicago truncatula miR2648 stem-loop
Stem-loop
   c   u   g     u       -      ga  a     uu  cucugaauuaauucaaaagcuacau 
5'  ucu ggu uaugu ugauagc caaugg  au acaga  ca                         u
    ||| ||| ||||| ||||||| ||||||  || |||||  ||                         a
3'  agg uca auaca gcuauug guuacc  ua ugucu  gu                         c
   u   u   g     u       u      uc  c     ug  caaacauuuucgaugcuuuacauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 37785921-37786058 [-]
intergenic
Database links

Mature sequence mtr-miR2648

Accession MIMAT0013420
Sequence

19 - 

uagccaaugggaauaacagau

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).