Stem-loop sequence mtr-MIR2649

AccessionMI0011968 (change log)
DescriptionMedicago truncatula miR2649 stem-loop
Stem-loop
   a   -uga ug a    ag gg    a                     c  a 
5'  gcu    u  u agca  u  auaa uggcaccuuuuguaagcucuu au u
    |||    |  | ||||  |  |||| ||||||||||||||||||||| ||  
3'  ugg    a  a uugu  g  uauu accguggaaaacauucgagaa ua u
   a   uaua gu a    gu ag    a                     a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 19670625-19670729 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2649
mtr-MIR2649chr6: 19670625-19670729 [+]
mtr-MIR2678chr6: 19671276-19671704 [-]
Database links

Mature sequence mtr-miR2649

Accession MIMAT0013421
Sequence

69 - 

aaaggugccaauuaugagugu

 - 89

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).