Stem-loop sequence mtr-MIR2650

AccessionMI0011969 (change log)
DescriptionMedicago truncatula miR2650 stem-loop
Stem-loop
   a  cu   u     c  ac             ca  c  u                 a       a              g  uuuua 
5'  gu  caa uauuu aa  uuaaauauguuuu  gu cc acauuuugcgugacuuu aagaaua ucuuuauauuuuag ga     a
    ||  ||| ||||| ||  |||||||||||||  || || ||||||||||||||||| ||||||| |||||||||||||| ||      
3'  ca  guu auaaa uu  aauuuauacaaaa  ca gg uguaaaacgcacugaaa uuuuuau aggaauguaaaguu uu     a
   c  ag   u     a  cc             ag  a  c                 a       c              a  uacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 3163401-3163578 [+]
intergenic
Database links

Mature sequence mtr-miR2650

Accession MIMAT0013422
Sequence

17 - 

aacuuaaauauguuuucagucc

 - 38

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).