Stem-loop sequence mtr-MIR2651

AccessionMI0011970 (change log)
DescriptionMedicago truncatula miR2651 stem-loop
Stem-loop
   a      ug                                                  ----ccuuuu    uu 
5'  uugggg  caauauaauuuaaugcaggcauacuagucaaauuauuugguuuaauuucc          gagg  u
    ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||          ||||   
3'  aacccc  guuauguuaaauuacguccguaugguuaguuuaauaaacuaaguuaaagg          uucu  u
   -      gu                                                  uuuacauguu    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 31685421-31685567 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2651
mtr-MIR2086chr2: 31686255-31686356 [-]
mtr-MIR2651chr2: 31685421-31685567 [-]
Database links

Mature sequence mtr-miR2651

Accession MIMAT0013423
Sequence

108 - 

uuugauugguaugccugcauu

 - 128

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).