Stem-loop sequence mtr-MIR2652a

AccessionMI0011971 (change log)
DescriptionMedicago truncatula miR2652a stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   g                                              u    a     --g    acaacuaacaaaaaccauuuccacagcaaaaugguuuugacauaauuuuaugcagggug 
5'  cgauuauggugcauaaggaaauucuuaugcacccugcauaaaucca aaau guuuu   gagu                                                           c
    |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||   ||||                                                            
3'  gcuaauaccacguauuccuuuaggaauacgugggacguauuuaggu uuua caaag   cuca                                                           u
   -                                              c    c     aca    acaugagguuuugguaaucuacaugaauuaccaaaggucgugggacguauuccuaaagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 30023475-30023721 [-]
intergenic
Database links

Mature sequence mtr-miR2652a

Accession MIMAT0013424
Sequence

208 - 

uaugcagggugcauaaggauu

 - 228

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).