Stem-loop sequence mtr-MIR2652b

AccessionMI0011972 (change log)
DescriptionMedicago truncatula miR2652b stem-loop
Gene family MIPF0000819; MIR2652
Stem-loop
   g                                           c             --g    aca   c      accauuuccacaucaaaaugauuuuggcauaauugggcug 
5'  cgguuauggugcauaaggaaaucuuuaugcacccugcauaaau cagaaaugguuuu   gagu   acu acagaa                                        g
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||   ||||   ||| ||||||                                        g
3'  gccaauaccacguauuccuuuaggaauacgugggacguauuua guuuuuaccaaaa   cuca   uga uguuuu                                        a
   -                                           a             aca    gca   -      aguaaucuacaugaauuaccaaaggucgugagacguauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 10180420-10180654 [-]
intergenic
Database links

Mature sequence mtr-miR2652b

Accession MIMAT0013425
Sequence

196 - 

uaugcagggugcauaaggauu

 - 216

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).